"Assay of enzyme activity" 검색결과 1-20 / 122건

• 

  경희대학교 생리유전학실험 - 미생물유전학 실험 최종 보고서(A+보고서)

  Introduction: molecular analysis of active domains in the Ferritin of Deinococcus geothermalis2. ... SDS-PAGEIntroduction: Molecular analysis of active domains in the Ferritin of Deinococcus geothermalis철 ... Oxidative stress response & CFU Assay7.

  리포트 | 38페이지 | 5,000원 | 등록일 2022.07.12

  다운로드 장바구니
• 

  [생물화학공학및실험 A+] Enzyme activity assay

  결과레포트실 험 제 목 :Enzyme activity assay조 :학 번 :이 름 :1. ... 있으므로U/mg_enzyme의 단위를 갖는 효소의 비활성도까지 계산할 수 있다. ... : 예측 값)4) 효소의 비활성도(specific Activity)추가적으로 본 실험에 사용한 효소의 밀도 값이 주어진다면 넣어준 부피 20mu l를 곱해 효소의 질량을 계산할 수

  리포트 | 6페이지 | 2,000원 | 등록일 2021.01.19 | 수정일 2021.01.20

  다운로드 장바구니
• 

  천연물생리활성방법론

  (I) Enzyme assay and (II) Viability Test. ... : The MTT assay is used to measure cellular metabolic activity as an indicator of cell viability, proliferation ... (Describe the action mechanisms of a representative phase II enzyme as a cancer chemopreventive enzymes

  시험자료 | 5페이지 | 3,000원 | 등록일 2021.09.21

  다운로드 장바구니
• 

  효소반응실험 Enzyme activity-Colorimetric of catalase activity

  Enzyme activity-Colorimetric of catalase activity2303078 이서현IntroductionEnzymeEnzyme은 생체 내의 화학반응을 촉진하는 ... Activity는 기질이나 생성물의 농도 변화를 측정함으로써 알아낼 수 있다. Enzyme assay의 종류에는 direct, indirect type 2가지가 있다. ... assayEnzyme assay는 enzymatic activity를 측정해내는 방법이다.

  리포트 | 6페이지 | 2,000원 | 등록일 2024.07.05

  다운로드 장바구니
• 

  건국대학교 핵산생화학 중간고사 족보

  이를 증명하는 실험으로 hyperchromicity assay, DNA digestion assay, DNA nicking activity assay를 진행했다. ... The enzymatic activity of the DNAse I variants was tested using a DNA hyperchromicity assay. ... 이러한 관점에서 SLE를 가진 쥐와 비교해보았을 때에 그 DNA의 양이 10배 차이가 나는 것을 보아, 적절하게 이동하지 못한 염화물에 의해 Enzyme의 activity가 영향을

  시험자료 | 11페이지 | 3,000원 | 등록일 2024.06.26

  다운로드 장바구니
• 

  (90x120cm) 학회 논문 포스터 졸업 논문 발표 포스터 PPT양식

  ABTS radical scavenging activity (A), reducing power (B), and NO radical scavenging activity (C) of EECM ... immunosorbent assay kit. ... the supernatant were collected and insulin release levels were determined using a rat/mouse insulin enzyme-linked

  ppt테마 | 1페이지 | 5,000원 | 등록일 2022.12.28

  다운로드 장바구니
• 

  Stenotrophomonas maltophilia 유래 Oleate Hydratase와 Alcohol dehydrogenase의 Enzyme cascade reaction

  Staphylococcus aureus Oleate Hydratase의 Active site(좌)와 reaction mechanism(우)Target enzyme인 SmOhyA의 경우 ... Ohys의 kinetic assay에 사용될 용액들은 정확한 assay condition을 고려하여 주의해서 사용되어야 하고, 선행 논문에서 제시된 도출된 값은 예외 없이 ‘비활성’ ... acid일 때 효소 ADH의 농도에 따른 흡광도를 이용하여 NADH 농도를 계산했다.이 때, A는 absorbance, 는 extinction coefficient(, l은 width of

  리포트 | 12페이지 | 2,500원 | 등록일 2024.04.03

  다운로드 장바구니
• 

  (90x120cm) 학회 논문 포스터 졸업 논문 발표 포스터 PPT양식

  quantification of insulin in mouse and rat sera Antioxidant activities - ABTS radical scavenging activity ... immunosorbent assay kit. ... Antioxidative and antidiabetic activities of Cornus macrophylla in MIN6N pancreatic beta-cells Gil Dong

  ppt테마 | 1페이지 | 5,000원 | 등록일 2022.12.28

  다운로드 장바구니
• 

  [A+ 연세대][2019 1학기 진행] 미생물및생물공학기초실험 Lab 8: Screening Natural Inhibitory Compounds on Melanin Biosynthesis 결과레포트

  Tyrosinase Inhibition Assay is used in order to screen the inhibition of tyrosinase activity. ... polymerization various enzymes are involved and tyrosinase is the enzyme that is rate-limiting. ... % tyrosinase inhibition activity and relative concentration(mM) of each sample.

  리포트 | 7페이지 | 3,000원 | 등록일 2019.08.26

  다운로드 장바구니
• 

  28도에서의 SNC1 단백질과 Nup96의 상관관계

  Enzyme site 및 Frameshift 고려한 Primer Designoverlapping sequence of the mutation site: TAATAGATAAAGAATCGTTCAAAGGE ... Enzyme site 및 Frameshift 고려한 Primer Designoverlapping DNA sequence of SNC1 cdsforward: ATGATGGATACATCCAAAGAreverse ... Vector 선택 및 제한효소 선택MCS 앞에 DNA-binding domain 서열을 갖는 pGBKT7 vector와 MCS 앞에 activation domain 서열을 갖는 pGADT7

  리포트 | 5페이지 | 2,500원 | 등록일 2024.06.02

  다운로드 장바구니
• 

  Medium Supplementation with Rare Earth Elements Reduces Hyperhydricity during Adventitious Shoot Multiplication In Vitro of Carnation

  한국화훼학회 Bo Ling Liu, Hao Wei, Ji Eun Park, Byoung Ryong Jeong

  논문 | 10페이지 | 4,000원 | 등록일 2023.04.05 | 수정일 2023.04.06

  다운로드 장바구니
• 

  LPS 농도가 TNF-alpha를 생산하는 대식세포에 미치는 영향 및 ELISA에 의한 TNF-alpha 정량화

  (Takashiba et al., 1999).TNFα levels can be measured by enzyme-linked immunosorbent assay (ELISA) which ... TNFα is a transmembrane 26 KDa protein expressed by activated monocytes/macrophages and other cells of ... These assays are also very specific because of using two antibo death such as necrosis and apoptosis,

  리포트 | 10페이지 | 3,000원 | 등록일 2021.08.03

  다운로드 장바구니
• 

  학점4.5/학과수석/실험강좌수석/보고서만점-Enzyme kinetic assay:Horseradish peroxide 예비 및 결과보고서/ 효소반응속도론

  A common use for it is in the enzyme-linked immunosorbent assay (ELISA) to detect for binding of molecules ... Enzyme kinetic assay: Horseradish Peroxidase예비 보고서Ⅰ. ... enzyme, or to simply quantify the amount of hydrogen peroxide in a sample.The formal reduction potentials

  리포트 | 22페이지 | 3,000원 | 등록일 2020.03.31 | 수정일 2020.05.15

  다운로드 장바구니
• 

  A+보장, 생화학 MTS TEST, MTS ASSAY 예비레포트

  is reduced to purple formazan in living cells.- NAD(P)H-dependent cellular oxidoreductase enzymes are ... 이러한 원리로 세포 내의 mitochondrial NADH-dehydrogenase activity측정에 이용 하면, 매우 민감한 방법으로서 Cytotoxicity, cell proliferation ... 세포가 quiescence) of potential medicinal agents and toxic materials.● MTT assay- MTT, a yellow tetrazole

  리포트 | 5페이지 | 1,500원 | 등록일 2019.12.25

  다운로드 장바구니
• 

  서강대-분자 생물학

  -Nucleotide excision repair enzyme cleave damaged DNA on either side of the lesion. ... gel shift assay, gel retardation assay등을 사용한다. ... (읽어보기)-The Xer recombinase catalyzes the monomerization of bacterial chromosomes and of many bacterial

  시험자료 | 66페이지 | 무료 | 등록일 2020.11.17 | 수정일 2021.01.06

  다운로드 장바구니
• 

  토양미생물활성측정 예비보고서

  APA는 lysosomal enzyme으로 acid pH에서 organic phosphates를 가수분해하므로 활성도를 알 수 있다. ... 또한 subtrate마다 optimal temperature를 참고해야 한다. β-glucosidase activity (U/L)는 β - Glucosidase Activity = ... 참고문헌: 김수진, Characterization of a New β -Glucosidase Encoded in Metagenome of Non-cultured Soil Microorganisms

  리포트 | 3페이지 | 2,000원 | 등록일 2019.12.21

  다운로드 장바구니
• 

  효소반응속도론

  DeterminingK _{m} value of alkaline phosphatase (1~5 번은 각 4개씩 준비한다.) ... (1) Michaelis-Menten kinetics 반응모델-효소는 기질과 결합할 수 있는 Active site가 일정하기 때문에 높은 기질 농도에서 Active site 모두가 ... 실험방법< Assays Method >1) Spectrophotometer를 켜서 warm-up 시키고, 파장을 410 nm로 맞춘다.2) Substrate를 제외한 reaction

  리포트 | 8페이지 | 1,500원 | 등록일 2023.09.30

  다운로드 장바구니
• 

  진단검사와 간호 - 약어

  inhibitior-1플라스미노겐 활성인자 억제-1PAPProstatic acid phosphatase전립선 산 인산효소Pco2Partial pressure of carb사선 요오드 ... POva and parasites알과 기생충OPGOculoplethysmography안구혈량계[P]PPhoshorus인PABPrealbumin전알부민PAI-1Plasminogen activator ... 항트립신ABETAuditory brainstem evoked potenrial청각관여 뇌간 유발전위ABGsArterial blood gases동맥혈가스ACEAngiotensin-converting enzyme안지오텐신

  리포트 | 6페이지 | 2,500원 | 등록일 2022.08.10

  다운로드 장바구니
• 

  예비6 Enzyme activity assay 김

  효소-기질 복합체 형성 과정③효소 활성(Enzyme Activity) & 효소 활성도 단위 (Unit of Enzyme Activity)효소 활성이란 단위 시간당 변환을 받은 기질의 ... 예비레포트실험제목 :Enzyme activity assay조 :5조학 번 :2015117014이 름 :김선준1. 실험 목적본 실험은 광분해 반응 물질에서 효소 사용의 유? ... 바탕 이론①효소(Enzyme)효소는 단백질의 일종으로 화학 반응에서 반응 물질 외에 미량의 촉매 역할로 반응 속도를 증가하는 효과를 가진다.

  리포트 | 10페이지 | 3,000원 | 등록일 2021.02.07

  다운로드 장바구니
• 

  A+보장, 생화학 MTS TEST, MTS ASSAY 결과레포트

  of an isolated enzyme, or reduction in fluorescence for a luciferase reporter assay for an individual ... the desired activity. ... 제11-12주차 MTS ASSAY 결과 Report1.

  리포트 | 7페이지 | 1,500원 | 등록일 2019.12.25

  다운로드 장바구니