"Sequencing Nucleic A" 검색결과 1-20 / 30건

• 

  아주대학교 생물학실험1 A+ 생물정보학 보고서

  term_slug=&sa_term=scidictionary[2]: Britannica, nucleic acid, Hyperlink "https://www.britannica.com/ ... Multiple Sequence Alignment 실습과제6. ... query=nucleic+acid" https://www.britannica.com/search?

  리포트 | 15페이지 | 1,500원 | 등록일 2023.01.14

  다운로드 장바구니
• 

  게놈혁명과 호모 헌드레드 1주차

  있음을 규명→ A T G C 가 1대1대1대1 비율로 존재※ Nucleic Acid→ 염기: Pyrimidine계와 Purine계→ Pyrimidine계 - 시토신 티민 / 유라실 ... DNA를 합성하기 위해서는 4개의 A T G C를 넣어야 한다.(4개의 A T G C를 합쳐서 dNTP라고 함)Ⅱ. ... .※ 리차드 알트만 (1889년)→ 뉴클레인이 산성을 띄고 있음을 알아내고 Nucleic Acid 핵산이라 명명.※ 포버스 레빈→ 핵산이 하나의 단위체인 Nucleotide로 구성되어

  리포트 | 15페이지 | 1,000원 | 등록일 2020.11.13

  다운로드 장바구니
• 

  Chemical properties of biological molecules

  acid (RNA) - Sequence of nucleotides housing the genetic code for an organism cAMP ATP Other functions ... acids8 Nucleic acids Nucleic acid types (based on sugar in nucleotide) Deoxyribonucleic acid (DNA) Ribonucleic ... water molecule, Forming a new bond Long polymer Hydrolysis adds a water molecule, Breaking bond4 Isomer

  리포트 | 19페이지 | 2,000원 | 등록일 2020.03.29

  다운로드 장바구니
• 

  DNA/RNA 구조의 이해

  _(Hardison)/Unit_I%3A_Genes%2C_Nucleic_Acids%2C_Genomes_and_Chromosomes/2%3A_Structures_of_Nucleic_Acids ... _(Hardison)/Unit_I%3A_Genes%2C_Nucleic_Acids%2C_Genomes_and_Chromosomes/2%3A_Structures_of_Nucleic_Acids ... 결과적으로 3가지의 구조가 도출되었다.RNA 구조 예측Sequence: AGCCCGCCUAAUGAGCGGGCU4. Discussion4-1) 왜 DNA는 이중나선 구조를 가지는가?

  리포트 | 4페이지 | 1,000원 | 등록일 2020.09.09 | 수정일 2020.10.13

  다운로드 장바구니
• 

  서강대학교 현생실2 Site-directed mutagenesis를 통한 Mutagenic reaction, Transformation과 Sample DNA의 DNA 서열 분석

  electrophoresis는 Agarose를 포함한 Gel에 전기적인 힘으로 DNA를 음극에서 양극으로 이동시켜 원하는 DNA를 분리하고 시각화하는 방법이다.Fig.2 pET-21a( ... 일어나는 특징으로 Protein을 Induction하는 Mutagenesis를 할 때 효율이 좋다.DNA sequencing은 생화학적 방법등을 DNA의 Nucleotide 순서인 Nucleic ... 통해 Sequence의 Peak를 확인하고 프로그램에서 추출된 Sequence를 가지고 제한효소 부위와 Open reading frame 부위를 찾을 수 있다.

  리포트 | 14페이지 | 3,000원 | 등록일 2022.09.05

  다운로드 장바구니
• 

  [생명공학 레포트] gDNA isolation 및 T7E1 assay를 통한 genome editing 확인

  2018Richard A. ... Adamietz P, “Stimulation of Proteinase K action by denaturing agents: application to the isolation of nucleic ... 전기영동을 하면 절단된 DNA는 최소 2개 이상의 선이 나타나게 되는데 이를 통해서 Genome Editing이 성공적으로 이루어 졌는지 확인 할 수 있다.Next Generation Sequencing

  리포트 | 6페이지 | 1,000원 | 등록일 2023.03.14

  다운로드 장바구니
• 

  생화학 요점

  Pentose phosphate pathway의 중요한 생화학적 의의1) Ribose의 생합성 mechanism- Ribose는 nucleic acid(DNA, RNA)의 구성성분- ... vector: 운반체- 제한효소: DNA의 특정 Sequence 부위 : 표준상태에서 전자공여체와 수용체 사이에 발생하는 환원전위변화* 전자는 more positive E를 가진 반쪽전지로 ... 검정② Northern Hybridization: DNA와 RNA의 유사성 검정③ Western Hybridization: 단백질과 단백질의 유사성 검정*제한효소: DNA의 특정 Sequence

  리포트 | 9페이지 | 1,500원 | 등록일 2021.06.16

  다운로드 장바구니
• 

  Genotyping(PCR, Gel electrophoresis) A+ report

  ① 94℃, 2min ② 94℃, 30sec ③ 60℃, 30sec ④ 72℃, 1min X 30cycles (②,③,④) ⑤ 72℃, 5min ⑥ 4℃, ∞ * Primers Sequence ... 랩으로 덮은 뒤에 Microwave에 30초 동안 녹여준다. (3번 반복) ③ 혼합물이 다 녹았는지 확인한 후, 데워진 열기를 약 5min간 식혀준 뒤에 20000x StaySafe Nucleic ... Genomic DNA Genomic DNA(gDNA)는 긴 이중사슬로서, 핵 내에 존재하는 유기체 내의 chromosomal DNA이다. gDNA는 A, T, G, C의 염기쌍들이

  리포트 | 17페이지 | 3,500원 | 등록일 2024.07.02

  다운로드 장바구니
• 

  응용미생물학 정리 Genetic engineering for Microbiology

  labeled bases (현재는 fluorescent dye 사용), gel electrophoresis 사용Polymerase chain reaction (PCR) : amplify a ... 확인하기 위해 restriction enzyme으로 잘라보는 것Agar: agarose(pure polymer)와 agaropectin(heterogeneous mixture)의 혼합물Nucleic ... 유전자 가위' 진화는 계속된다”, 한국경제, 2020.09.18이영완, “질병 뿌리 잘라낼 유전자 가위 발견… 여성 과학자 2人, 노벨 화학상 수상”, 조선일보, 2020.10.08Sequencing

  리포트 | 6페이지 | 1,000원 | 등록일 2020.12.25

  다운로드 장바구니
• 

  Sanger sequencing

  프라이머와 dNTP는 핵산(Nucleic acid)으로 이루어졌으며 인산기를 떼주는 효소를 제거하여준다.Exonuclease I을 쓰는 목적은 핵산을 없애는 효소이며 이는 바깥쪽부터 ... Sanger Sequencing의 원리을 보면, ssDNA를 먼저 집어넣어 주면서 상보적인 폴리 뉴클레오타이드 사슬의 효소적 합성이 이루어지면서 특정 뉴클레오타이드 위치에서의 종결이 ... 이면 정상 미맹이면 구아닌(G)으로 구성되어 있으며, 785bp는 정상은 시토신(C) 미맹은 티민(T)으로 구성되어 있다. 886bp의 경우에는 정상은 구아닌(G) 미맹은 아데닌(A)

  리포트 | 6페이지 | 1,000원 | 등록일 2019.11.09 | 수정일 2022.11.19

  다운로드 장바구니
• 

  분자세포생물학 핵심 요약

  T1, pancreatic Rnase)- restriction endonuclease- some RNAs catalytic activity[RNA enzyme, Ribozyme]Sequencing ... acid· AA(Amino Acid)종류 20가지· Nucleic acid = (Nucleotide)n= Polynucleotide· Nucleotide = ribose + base ... growth, division, specializationmovement, interaction· 3 kinds of macromolecules· Function of protein & Nucleic

  시험자료 | 2페이지 | 1,500원 | 등록일 2016.05.12

  다운로드 장바구니
• 

  카이스트 Bioengineering Laboratory 1 lab3_prelab [protein structure prediction]

  즉 Sequence Identity가 높고, E-value가 낮은 template sequence를 골라야 한다. 5의 sequence들 중에서 7mdh_A가 가장 낮은 E-value와 ... What is comparative structure modeling (homology modeling) of a protein? ... Pdb 파일에는 단백질과 nucleic acid의 분자배열, sidechain의 이성질체 형태, 2차구조, 그리고 분자적 구조 등이 기록되어 있다.Compare two alignment

  리포트 | 3페이지 | 1,000원 | 등록일 2015.01.04

  다운로드 장바구니
• 

  NGS에 대하여

  NGS(Next Generation Sequencing)에 대하여1. ... 부분 NGS 기술이 PCR이나 마이크로어레이 기술 등을 대체할 것이다 (그림4).그림 4 Relative sample and data throughputs for different nucleic ... single base-pair location (a C/T polymorphism).3.

  리포트 | 4페이지 | 1,000원 | 등록일 2014.08.20

  다운로드 장바구니
• 

  SDS PAGE GEL (running gel & stacking gel ) 조성표 및 Acrylamide % 선택 가이드 한쪽 정리 한글문서

  서식 | 1페이지 | 500원 | 등록일 2013.09.03

  다운로드 장바구니
• 

  NMR강의

  15N d1H d“0”7.0 8.0185.0 165.0Isotopic labelingH, N correlation spectra: Fingerprint for proteins and nucleic ... FTZ-F1: TROSY-HNCO (600MHz)NH15N13CO3D- detect signals 3 timesSame as 1D experimentt2t1t33D NMR Pulse Sequence ... want a 15N labeled protein, we use 15NH4Ac (that is dirt-cheap).

  리포트 | 26페이지 | 1,000원 | 등록일 2014.09.13

  다운로드 장바구니
• 

  Surface Plasmon Resonance(SPR)

  Cloning and Sequencing 12 cycles Selected Library. Procedure.Figure 7. ... S E L E X Protein – nucleic acid interactionC o n t e n t s . Ⅰ Purpose. Ⅱ Introduction. Ⅲ 원리 . Ⅳ Methods ... Purpose.A p t a m e r .

  리포트 | 15페이지 | 1,000원 | 등록일 2013.10.14

  다운로드 장바구니
• 

  MLPA

  Nucleic Acids Res. Jun 15;30(12):e57. ... buffer: 250 -l (Blue cap) 9) SALSA Probemix: 160 -l (Black cap)RequirementsOverview of MLPAThermocycler Sequence ... dosage analysis made easy” First described by: Schouten JP et al. (2002) Relative quantification of 40 nucleic

  리포트 | 33페이지 | 2,500원 | 등록일 2010.11.19

  다운로드 장바구니
• 

  DNA,염색체, 유전자,게놈 에 대해서 서술하시오

  DNA 염기에는 아데닌(A), 티민(T), 구아닌(G), 시토신(C) 4 종류가 있으며 염기의 서열(DNA Sequence)이 유전정보를 나타낸다. ... 이를 연결하면 폭 1000억 분의 5cm, 길이 152cm가 되는데, 이 안에 약 30억 개의 염기쌍이 들어 있다.3.기능DNA(Deoxyribo Nucleic Acid)란 바로 설계도처럼 ... 염기 중 A는 T와, G는 C와 마주보고 있는데 이 A－T, G－C 구조는 DNA가 유전자로서의 기능을 나타내는 데 매우 중요한 의미가 있다.

  리포트 | 8페이지 | 2,000원 | 등록일 2013.05.15

  다운로드 장바구니
• 

  DNA methylation analysis

  the PCR, and cleavage of the reporter, all of which are affected by the presence of DNA methylation.Nucleic ... that don't cover CpGsMETHODS 25, 456–462 (2001)Genomic DNABisulfite conversionMethylation dependent Sequence ... TAMRA)quencher A quencher is that absorbs light but does not emit it.

  리포트 | 35페이지 | 2,000원 | 등록일 2010.11.17

  다운로드 장바구니
• 

  aptamer

  chosen target from a large pool of nucleic acidsStep 1Step One: Pool GenerationSynthesize oligonucleotides ... Sequencing the selected individual members of the library.RNA AptamerPost-SELEX ModificationPost-SELEX ... Systematic Evolution of Ligands by EXponential enrichmentIterative process used to identify an aptamer to a

  리포트 | 31페이지 | 1,000원 | 등록일 2010.09.15

  다운로드 장바구니